caramelatte
caramelatte caramelatte
  • 02-11-2018
  • Mathematics
contestada

What is this in an algebraic equation? 40 POINTS!

What is this in an algebraic equation 40 POINTS class=

Respuesta :

dernst041 dernst041
  • 02-11-2018
$2725 x .09= this is the amount that is tax
Answer Link
alananicolelatham34 alananicolelatham34
  • 02-11-2018
you multiply 2725 by .9 and you get 2,452.5 and then subtract 2,452.5 from 2725
Answer Link

Otras preguntas

what might be learned from an incorrect hypothesis
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which system of government would states function independently of each other?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take