charityvm4christ
charityvm4christ charityvm4christ
  • 02-12-2020
  • Mathematics
contestada

PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!

Solve -2t + 5 ≥ -7.


t ≤ 6
t ≤ -6
t ≥ 6
t ≥ -6

Respuesta :

thatgirl00
thatgirl00 thatgirl00
  • 02-12-2020
Hope that helped! The answer is t is less than or equal to 6
Ver imagen thatgirl00
Answer Link

Otras preguntas

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
What is the primary purpose of the Supremacy Clause?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
How do you write fifty-seven thousand,eighteen. In standard form
Why was wilson not able to finish his speaking tour
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5