shukriibrahim36
shukriibrahim36 shukriibrahim36
  • 03-12-2020
  • Biology
contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa
  • 03-12-2020
I don’t feel like answering all that but....
C=G G=C T=A A=U
Answer Link
vicgraisi1220
vicgraisi1220 vicgraisi1220
  • 03-12-2020
C=G A=T dont know the rest have a gcodocododd dday
Answer Link

Otras preguntas

Solve pls brainliest
if Rosa exercised 60 hours ain 5days. how many hours a day did she exercised?​
how can i answer 6x-3y=-6
i need to know what d=
Is 68.993 an irrational number? yes no
An inequality and its solution is shown below. 7x < 5x + 6 x < 3 Which of the following is part of the solution set? A. 0 3 C. None of these B. 4.5
Help Tali is researching former President Franklin Delano Roosevelt, and she finds the following website: http://www.whitehouse.gov/about/presidents/franklindr
Which statement best identifies a central idea of this text A. The government is a self-serving establishment with the sole goal of making more money for itsel
Click on the Start menu and then click on All Programs. How many different programs are listed?
which is the quotient of 3,456 divided by 24