vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

Choose the more precise measurement in the pair.  A .) 6.7 mi or  B.) 6 mi
A sound wave of 70 cm travels 840 m in 2.5 sec. What is the velocity and frequency of sound?
What's the other term for: explosive or changing very quickly
How to find the reference angle of -11pi/3 ?
if Xx8=y is the rule,and the value of x is 4, what is the value of y
Amy raised £n for charity. Chris raised £18 more then any. The mean amount raised by the two of them is £45. Work out how much money each one of them raised
round to the nearest hundredth 5.6192
A sound wave of 70 cm travels 840 m in 2.5 sec. What is the velocity and frequency of sound?
a subway train starts from rest at a station and accelerates uniformly at 1.8m/s^2 for 15 sec. then it runs at a constant speed for the next 35 sec. before dece
what is glossities and deficiency