SasusageUchiHa SasusageUchiHa

03-12-2020
Mathematics

contestada

''The world shall know pain'' Me: Pain or Pain???????????????

Respuesta :

jadaconnell jadaconnell

03-12-2020

Answer:

PAIN

Step-by-step explanation:

Answer Link

Otras preguntas

Why did French in Anglo-Saxons languages merge

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

The probability that the sum of the numbers rolled is either even or a multiple of 5 is

Why does Machiavelli mention Pisa at the end of the passage? city accustomed to may expect to be nas always the mt privileges as a nor benefits will ever ou ma

If a color change occurs when two solutions are mixed is it true that a chemical react has probably taken place?

Zinc(II) sulfide reacts with oxygen according to the reaction: A reaction mixture initially contains 3.0 mol ZnS and 2.0 mol O2. Once the reaction has occu

A team of engineers at General Motors is in charge of discovering new knowledge that can be used to make automobiles safer and more economical. These engineers

Please help!! A picture measuring 4 inches by 6 inches is placed inside a frame which has equal width around the entire picture. If the area of the frame and th

i’m having trouble understanding this question.

Which function represents a reflection of f(x) = Three-sevenths(2)x over the x-axis? g(x) = –Three-sevenths(2)x g(x) = Three-sevenths(–2)x g(x) = Three-sevenths