kinginmyland593 kinginmyland593
  • 02-03-2021
  • Mathematics
contestada

Is what I did a correct step?
If so, what is the next step?
​

Is what I did a correct stepIf so what is the next step class=

Respuesta :

Alphawolf10115
Alphawolf10115 Alphawolf10115
  • 02-03-2021
Next step would be 5x10x5
Answer Link

Otras preguntas

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
i need help with this question
Help pl0x, Algebra 1
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
What would be the most likely effect of one company buying a competitor?
A generator stores electric current. Explain why you agree or disagree with this statement