Traesmith1435 Traesmith1435

01-12-2016
Biology

contestada

Name at least 4 other gases besides oxygen and nitrogen

Respuesta :

01-12-2016

Hydrogen, Helium, Carbon and Phosphorus

Answer Link

Otras preguntas

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

Homosociality reflects children's tendency to prefer social interactions with

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these

stars and planets are made from gases in a

A tree casts a shadow 32 ft long. at the same time, the shadow cast by a vertical 8-ft post is 4 ft long. find the height of the tree.

What factors can affect mental health

TRUE OR FALSE HELP QUICK