claireaddison43 claireaddison43

03-09-2021
English

contestada

Highlight the verb(s).
The dancers imitate Kermit the Frog's groovy moves.
Submit answer
Report a problem

Respuesta :

arzolairam0 arzolairam0

03-09-2021

Answer:

dancers, moves

Explanation:

Answer Link

Otras preguntas

Why were senators able to amass more power and influence than congressmen during the gilded age?

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.

Can you help me to find this answer, please, I need help

HELP FAST!!!! Solve the compound inequality, showing your work. Name the solution set and then draw the graph of the solution set. x-3≤-7 or x-3≥1

Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei

What advice would you give someone whose life dream is to become a judge?

Improved functional health can be a positive influence on which health risk/