username827383
username827383 username827383
  • 01-10-2021
  • Mathematics
contestada

56 + n = 107
Pls help it’s timed

Respuesta :

zmcever
zmcever zmcever
  • 01-10-2021

Answer:

n = 51

Step-by-step explanation:

You can rearrange this to make it easier:

107-56=n

51=n

Answer Link

Otras preguntas

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side
2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.
Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new
what does a light year measure
100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f
(-6x^3+2x^2-2x)/(2x-1) how do I solve using long division?
A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf