Anna0114 Anna0114
  • 01-06-2015
  • Mathematics
contestada

what are the zeros of (x-2)(x^2-9)

Respuesta :

Аноним Аноним
  • 01-06-2015
[tex](x-2)(x^2-9)=0\iff x-2=0\ or\ x^2-9=0\\\\x-2=0\ \ \ \ |add\ 2\ to\ both\ sides\\\\\boxed{x=2}\\\\x^2-9=0\ \ \ \ |add\ 9\ to\ both\ sides\\\\x^2=9\iff x=\pm\sqrt9\to \boxed{x=-3\ or\ x=3}\\\\Answer:\boxed{x=-3\ or\ x=2\ or\ x=3}[/tex]
Answer Link

Otras preguntas

the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
why is it critical to your cells to be near capillaries
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
What is the sum of 6/10 plus 7/12
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the