janellecastellowu4fk janellecastellowu4fk
  • 02-10-2017
  • Mathematics
contestada

convert the function into standard form. y=2(x-4)(x+3)

Respuesta :

1800071
1800071 1800071
  • 02-10-2017
the awnser is y=2xsquared -2
Answer Link
99taymar 99taymar
  • 02-10-2017
y=2x^2-24

distribute the 2 to x-4 then foil 2x-4 and x+3
Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
how do you say theatre in Spanish
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
does radiation need a phase of matter to travel with?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5