eliperez1299 eliperez1299
  • 01-03-2018
  • Health
contestada

List some common warning signs of substance abuse.

Respuesta :

student182
student182 student182
  • 16-04-2021

Answer:

Increased aggression or irritability.Changes in attitude/personality.

Explanation:

Answer Link
edebevoris edebevoris
  • 02-07-2021

Answer:

constant talk about drugs

Answer Link

Otras preguntas

Sancho Panza is the farmer who acts as Quixote's 1._______. When Quixote attacks a 2.______ in the passage, Panza him 3_______. the choices for these are 1.co
Do cones and polyhedrons both have only one base true or false
A federal program that guarantees benefits to qualified recipients is a(n) ________ program
How did the Bataan Death March gets its name
describe how the resistance of the filament lamp changes as the current through it increases.
At age 76 years, which chronic condition is elizabeth most likely to have?
if f(x)=4x-6, what is f(6)
which of the following countries did the u.s. lend-lease military equipment to A. Germany B. spain C.great britian D.italy
What are two concepts of government democracy?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat