jennzimm13p4gqlw
jennzimm13p4gqlw jennzimm13p4gqlw
  • 02-03-2018
  • Mathematics
contestada

What binomial must be subtracted from 7t-5) so that the difference of the 2 polynomials is (5r+8)?

Respuesta :

Edufirst
Edufirst Edufirst
  • 02-03-2018
1) Given binomials:

First binomial 7r - 5
Second binomial 5r + 8

2) To pass from 7r to 5r you have to subtract 2r, so the first term of the binomial to be subtracted is 2r

3) To pass form - 5 to + 8, you have fo subtract  - 13

4) So the answer is 2r - 13, option b.

Answer Link

Otras preguntas

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?
Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.
Which type of oscillation would most likely produce an electromagnetic wave?
The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u
What major events led to the establishment of the navy and the department of the navy?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Write the polynomial in standard form. then name the polynomial based on its degree and number of terms.2 – 11x2 – 8x + 6x2
The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these
4 (2x-6)=10x-6. solve for x
can someone help me please